BIF501 Midterm Solved Questions

BIF 501 Mid Current Solved questions

1- Why Sequencing are submit in database? Write precaution of sequencing?

Sequences are submitted to the databases in order to share them with the scientific community Generally sequences are submitted at the time of publication and are reviewed by peers. Caution: It is important to ensure that sequence files do not contain any special characters • Control characters in addition to standard ASCII characters must be removed else they might mess up the analysis or data transfer.

2- Delete the one, two and three nucleotide from strand with example?

3- Translation of protein?

Protein synthesis is accomplished through a process called translation. After DNA is transcribed into a messenger RNA (mRNA) molecule during transcription, the mRNA must be translated to produce a protein. In translation, mRNA along with transfer RNA (tRNA) and ribosomes work together to produce proteins.

4- What are MITES?

MITES (Miniature Inverted repeat TEs) – Features of both Class I and II – 400 bp. (PPTS)

5- Genequiz and MAGPIE?

MAGPIE (Multipurpose Automated Genome Project Investigation Environment) It’s an automated genome analysis tool that is used for structural annotation. GeneQuiz Focuses on deriving a predicted protein function based upon available evidence, including evaluation of similarity to the closest homologue in database.

6- Genome and Genome informatics? 2

Genome: Genome sequencing provides the sequences of all the genes of an organism • A major application of Bioinformatics is analysis of full genomes that have been sequenced. Challenge is to identify those genes that are predicte d to have a particular biological function Genome Information: Genome informatics is the field in which computational and statistical techniques are applied to derive biological information from genome sequences. Genome informatics includes methods to analyze DNA sequence information and to predict protein sequence and structure.

7- Restriction Enzyme?

A restriction enzyme is a protein that recognizes a specific, short nucleotide sequence and cuts the DNA only at that specific site, which is known as restriction site or target sequence. More than 400 restriction enzymes have been isolated from the bacteria that manufacture them. (Intenet)

8- Exon Changing?

The weight of the path is defined as optimal alignment score between concatenated labels (blocks) and target sequence. ... Exon Chaining assumes the positions and weights of exons are predefined.

(Internet)

Five weighted intervals, (2, 3, 3), (4, 8, 6), (9, 10, 1), (11, 15, 7), and (16, 18, 4), shown by bold edges, form an optimal solution to the Exon Chaining problem. The array at the bottom shows the values s1 , s2 , . . . , s2n generated by the EXONCHANING algorithm. (PPTS)

9- Three Steps of Genome annotation?

Genome annotation is an important first step in genome analysis, based on; • Finding significant alignment to sequences of known function in databases. There are two steps in genome annotation • Structural annotation • Functional annotation.

10- Structural Annotation

Identification of gene features like; • Promoters • Terminators • Shine-Dalgarno sites • DNA motifs • Co-transcription units • Operons in microbes.

11- Note on ORF?

Open reading frames (ORFs) Fenome of length n as a sequence of n/3 codons The three ͞stop͟ codons, (TAA, TAG, and TGA) The subsegments of these that start from a start codon, ATG, are ORFs. ORFs within a single genomic sequence may overlap since there are six possible ͞readiŶg fraŵes͟:three o Ŷ one strand starting at positions 1, 2, and 3, and three on the reverse strand. (In molecular genetics, an open reading frame (ORF) is the part of a reading frame that has the potential to be translated. An ORF is a continuous stretch of codons that contain a start codon (usually AUG) and a stop codon (usually UAA, UAG or UGA).[1] An ATG codon within the ORF (not necessarily the first) may indicate where translation starts. The transcription termination site is located after the ORF, beyond the translation stop codon. If transcription were to cease before the stop codon, an incomplete protein would be made during translation.[2] In eukaryotic genes with multiple exons, ORFs span intron/exon regions, which may be spliced together after transcription of the ORF to yield the final mRNA for protein translation.)

12-

ShineDalgarno sites • DNA motifs • Co -transcription units • Operons in microbes. MAGPIE (Multipurpose Automated Genome Project Investigation Environment) It’s an automated genome analysis tool that is used for structural annotation. (PPTS)

Structural annotations are physical regions of a genome that encode a genomic feature. Examples of such annotations are genes, mRNA, transcript, repeat sequences, (Internet)

13What Kind of Gene Expression OMNIBUS? Kind of Records of gene expression OMNIBUS (GEO)? 5 A public repository for the archiving and distribution of gene expression data submitted by the scientific community. MIAME compliant data – Minimum Information About a Microarray Experiment. Convenient for deposition of gene expression data, as required by funding agencies and journals • Curated resource for gene expression data • Browsing, querying, analysis and retrieval. GEO has four kinds of records • Sample (GSM) preparation and description of the samples • Platform (GPL) technology used and the features detected – microarray or RNASeq. Series (GSE) defines a set of samples and how they are related • Datasets (GDS) sample data collections assembled by GEO

14- EM BK note?

15- Brute runtime algorithm?

In actual cases, the performance (Runtime) of an algorithm depends on n, that is the size of the input or the number of operations is required for each input item. Runtime grows quicker than previous all based on n. Runtime grows even faster than polynomial algorithm based on n.

Collinear nucleotide?

Charles Yanofsky proved that a gene and its protein product are collinear. Yanofsky’s experiment was so influential that nobody even questioned about codons and for almost 2 decades biologists believed that a protein was encoded by a long string of adjacent triplets.

16- Four cases of pattern finding?

Pattern recognition is the automated recognition of patterns and regularities in data. Pattern recognition is closely related to artificial intelligence and machine learning,[1] together with applications such as data mining and knowledge discovery in databases (KDD), and is often used interchangeably with these terms. However, these are distinguished: machine learning is one approach to pattern recognition, while other approaches include hand-crafted (not learned) rules or heuristics; and pattern recognition is one approach to artificial intelligence, while other approaches include symbolic artificial intelligence

17- Pre Order Algorithm?

PREORDER(v)

1. output v
2. if v has children
3. PREORDER( left child of v )
4. PREORDER( right child of v )

Define Structure of annotation? Structural annotation? What we can do by using this

technique? Structural Annotation Identification of gene features like; • Promoters • Termina

18- MS2?

Infects E.Coli and Enterobacteriaceae • Single stranded sense RNA • Encodes MS2 coat protein. MS2 sequencing • The entire nucleotide sequence was established by nuclease digestion and characterization of fragments. MS2 genome • 49 different codons in the genetic code specify the sequence of the 129 aminoacids long coat polypeptide

19- KMP Matcher?

Knuth Morris Pratt (KMP) is an algorithm, which checks the characters from left to right. When a pattern has a subpattern appears more than one in the sub-pattern, it uses that property to improve the time complexity, also for in the worst case. The time complexity of KMP is O(n).J (Internet)

20- Edit the Manhatten Graph?

21- Application of Bioinformatics? Five application of bioinformatics?

Drug Development, Molecular Medicine, Crop Improvement, Personalized Medicine, Microbial Genome. Preventive Medicine, Gene Therapy. Biotechnology, Comparative Study.

22- Swiss Port, Fasta, Gene Bank, ORF?

SWISS-PROT: is an annotated protein sequence database established in 1986 and maintained collaboratively, since 1987, by the Department of Medical Biochemistry of the University of Geneva and the EMBL Data Library (now the EMBL Outstation -The European Bioinformatics Institute. FASTA Sequence Format • DNA sequences are stored in specified formats • Different softwares need sequences in different formats. FASTA is the most frequently used format to present DNA and Protein sequences • It is recommended that all lines of text be shorter than 80 characters in leng th Example: >gi|568815581:c7687550-7668402 Homo sapiens chromosome 17, GRCh38 Primary Assembly GATGGGATTGGGGTTTTCCCCTCCCATGTGCT CATCTAGAGCCACCGTCCAGGGAGCAGGTAGC TGCTGGGCTCTCCACGACGGTGACACGC--------

Genebank Format • A sequence file in GenBank format can contain several sequences • One sequence starts with a line containing the word LOCUS and a number of annotation lines. The start of the sequence is marked by a line containing "ORIGIN" and the end of the sequence is marked by two slashes ("//")

Example: ORIGIN 1 aacctgcgga aggatcatta ccgagtgcgg gtcctttggg cccaacctcc catccgtgtc 61 tattgtaccc tgttgcttcg gcgggcccgc cgcttgtcgg ccgccggggg ggcgcctctg 121 ccccccgggc ccgtgcccgc cggagacccc aacacgaaca ctgtctgaaa gcgtgcagtc 181 tgagttgatt gaatgcaatc agttaaaact ttcaacaatg gatctcttgg ttccggc //

23- Bypass Algorithm?

NEXTVERTEX Algorithm BYPASS Algorithm Skip the subtree rooted at vertex (a, i) Increment ai (unless ai = k BYPASS(a, i,L, k)

1. for j i to 1
2. if aj < k
3. aj aj

+ 1

4. return (a, j)

5. return (a, 0) (Proper Answer PPTS mn dykhain mujy ye sahi trha samj nh aaya)

24- Brute Force?

Brute force approach-find all local similarities Each substring from the genomic sequence that exhibits sufficient similarity to the target protein could be considered a putative exon Exon-flanking dinucleotides AG and GT Overlapping.